FuGENE 6 Transfection Reagent from Promega

Product Specs
ItemFuGENE 6 Transfection Reagent
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberE2692
Quantity5 x 1ml
Transfection MethodNon-liposomal
Transfection Sample TypeDNA, and Plasmid

Add to Compare List

Promega

2800 Woods Hollow Rd.

Madison, Wisconsin

United States

Phone: 800-356-9526
Fax: 800-356-1970

Company Profile

Website: http://www.promega.com

(1) Neuroprotective effect of Kurarinone against corticosterone‐induced cytotoxicity on rat hippocampal neurons by targeting BACE1 to activate P13K–AKT signaling – A potential treatment in insomnia disorderPharmacology Research & PerspectivesOctober 1, 2023Guoqing Wu, Yanyan Wuvector (PS100001, OriGene Technologies, USA) under the assistance of FuGENE® 6 Transfection Reagent (E2692, Promega, Madison, WI, USA). Briefly, 1 × 105 cells were put into 96‐well plates and cultivated overnight

(2) Host cell glycosylation selects for infection with CCR5- versus CXCR4-tropic HIV-1bioRxivSeptember 9, 2023Hannah L. Itell, Daryl Humes, Nell E. Baumgarten, Julie Overbaughproviral DNA and 200 μL serum-free DMEM were combined, prior to the addition of 18 μL of FuGENE (Promega #E2692). Pseudoviruses were also made by transfections using plasmids expressing the envelope of BG505.C233

(3) Overexpression of Eimeria tenella Rhoptry Kinase 2 Induces Early Production of SchizontsMicrobiology SpectrumAugust 17, 2023Adeline Ribeiro E. Silva, Mamadou Amadou Diallo, Alix Sausset, Thomas Robert, Stéphane Bach, Françoise I. Bussière, Fabrice Laurent, Sonia Lacroix-Lamandé, Anne SilvestrepcDNA-YFP-Flag, pcDNA-EtROP2-YFP-Flag, and pcDNA-EtROP2-Dead-YFP-Flag using 3 μL of FuGENE 6 (Promega, no. E2692) and 30 μL of Opti-MEM (Gibco, no. 31985062) according to the manufacturer’s recommendations. Transfected

(4) Elevated binding and functional antibody responses to SARS-CoV-2 in infants versus mothersNat CommunAugust 11, 2023Caitlin I. Stoddard, Kevin Sung, Zak A. Yaffe, Haidyn Weight, Guillaume Beaudoin-Bussières, Jared Galloway, Soren Gantt, Judith Adhiambo, Emily R. Begnel, Ednah Ojee, et al.penicillin/streptomycin/fungizone) in six-well dishes. After 16–23 h, cells were transfected using FuGene-6 (Promega #E2692) with the following constructs: the Luciferase_IRES_ZsGreen backbone, Gag/Pol, Rev, and Tat lentiviral

(5) RAB3 phosphorylation by pathogenic LRRK2 impairs trafficking of synaptic vesicle precursorsbioRxivJuly 28, 2023Dan Dou, Jayne Aiken, Erika L.F. HolzbaurU3003 DMEM (Dulbecco’s Modified Eagle’s Medium),Corning,Cat# MT10-013-CV FuGENE 6,Promega Corp.,Cat# E2692 GFP-Trap Magnetic Particles M-270,ChromoTek,Cat# gtd GFP-Trap Magnetic Agarose,ChromoTek,Cat# gtma Lambda

(6) SuPAR mediates viral response proteinuria by rapidly changing podocyte functionNature communicationsJuly 21, 2023Wei C, Datta PK, Siegerist F, Li J, Yashwanth S, Koh KH, Kriho NW, Ismail A, Luo S, Fischer T, et al.tag) and integrin aV subunit (C-terminal V5-HIS tag) fusion proteins using Fugene 6 reagent (Promega, E2692). Thirty-six hours after transfection, cells were harvested and cell pellets were resuspended in cell lysis

(7) Loss of ANCO1 Expression Regulates Chromatin Accessibility and Drives Progression of Early-Stage Triple-Negative Breast CancerInternational Journal of Molecular SciencesJuly 15, 2023Meng Yuan, Megan E. Barefoot, Kendell Peterson, Moray J. Campbell, Jan K. Blancato, Manjing Chen, Marcel O. Schmidt, Amber J. Kiliti, Hong-Bin Fang, Anton Wellstein, et al.for plasmid information). Cell transfection was performed using FuGENE6 (Promega, Madison, WI, USA, E2692) according to the manufacturer’s instructions. Briefly, the plasmids were mixed with FuGENE reagents

(8) Net39 protects muscle nuclei from mechanical stress during the pathogenesis of Emery-Dreifuss muscular dystrophyJournal of Clinical InvestigationJuly 3, 2023Yichi Zhang, Andres Ramirez-Martinez, Kenian Chen, John R. McAnally, Chunyu Cai, Mateusz Z. Durbacz, Francesco Chemello, Zhaoning Wang, Lin Xu, Rhonda Bassel-Duby, et al.generation of retroviruses and lentiviruses, respectively. Cells were transfected with FuGENE6 (Promega, E2692) per the manufacturer’s instructions. pMD2.G (Addgene, 12259) and psPax2 (Addgene, 12260) were used

(9) Generation of a MyoD knock-in reporter mouse line to study muscle stem cell dynamics and heterogeneityiScienceMay 19, 2023Fujita R, Mizuno S, Sadahiro T, Hayashi T, Sugasawa T, Sugiyama F, Ono Y, Takahashi S, Ieda M.Paraformaldehyde Fixative,"MUTO PURE CHEMICALS CO., LTD.",Cat# 33111 FuGENE 6 Transfection,Promega,Cat# E2692 PrimeSTAR Max DNA,TAKARA BIO Inc.,Cat# R045A Normal Goat Serum,Vector,Cat# S-1000 VECTASHIELD antifade

(10) Combination CDC-like kinase inhibition (CLK)/Dual-specificity tyrosine-regulated kinase (DYRK) and taxane therapy in CTNNB1 -mutated endometrial cancerbioRxivApril 11, 2023Bradley R Corr, Marisa R Moroney, Elizabeth Woodruff, Zachary L Watson, Kimberly R. Jordan, Thomas Danhorn, Courtney Bailey, Rebecca J Wolsky, Benjamin G Bitler(Addgene plasmid # 12457; http://n2t.net/addgene:12457; RRID:Addgene_12457). Using FuGENE6 reagent (Cat. E2692; Promega), populations were transfected with TOP-FLASH or FOP-FLASH plasmid. Cells were incubated for

(11) Activation of Gcn2 by small molecules designed to be inhibitorsJournal of Biological ChemistryApril 1, 2023Kenneth R. Carlson, Millie M. Georgiadis, Feven Tameire, Kirk A. Staschke, Ronald C. Wekand 1 ng nano-luciferase plasmids using a 3:1 ratio of FuGENE 6 transfection reagent (Promega Cat #E2692) to plasmid DNA. For experiments with Gadd34 expression, 100 ng of vector control or Gadd34 expression

(12) DNMT3A low-expression is correlated to poor prognosis in childhood B-ALL and confers resistance to daunorubicin on leukemic cellsBMC cancerMarch 18, 2023Li W, Liu S, Wang C, Cui L, Zhao X, Liu W, Zhang R, Li Z.psPAX2 (AddGene 12260) and 3 μg of VSV-G (AddGene 8454) using FuGENE® 6 Transfection Reagent (Promega E2692) according to the manufacturer’s instructions. After incubation for 48 h, the culture supernatants containing

(13) Neurotransmitter release progressively desynchronizes in induced human neurons during synapse maturation and agingCell reportsFebruary 28, 2023Uzay B, Houcek A, Ma ZZ, Konradi C, Monteggia LM, Kavalali ET.D5025 Matrigel,Corning,Catalog # 354234 Neurobasal Plus Medium,GIBCO,Catalog # A3582901 FuGENE 6,Promega,Catalog # E2692 QX-314,EMD-Millipore,Catalog # 552233 Transferrin,Calbiochem,Catalog # 616420 Cytosine Arabinoside

(14) Elevated binding and functional antibody responses to SARS-CoV-2 in infants versus mothersbioRxivFebruary 10, 2023Caitlin I. Stoddard, Kevin Sung, Zak A. Yaffe, Haidyn Weight, Guillaume Beaudoin-Bussières, Jared Galloway, Soren Gantt, Judith Adhiambo, Emily R. Begnel, Ednah Ojee, et al.penicillin/streptomycin/fungizone) in 6-well dishes. After 16–23 hours, cells were transfected using FuGene-6 (Promega #E2692) with the following constructs: the Luciferase_IRES_ZsGreen backbone, Gag/Pol, Rev, and Tat lentiviral

(15) TRF2 rescues telomere attrition and prolongs cell survival in Duchenne muscular dystrophy cardiomyocytes derived from human iPSCsProceedings of the National Academy of Sciences of the United States of AmericaFebruary 7, 2023Eguchi A, Gonzalez AFGS, Torres-Bigio SI, Koleckar K, Birnbaum F, Zhang JZ, Wang VY, Wu JC, Artandi SE, Blau HM.Virus Production. Retrovirus was produced in Phoenix Amphotropic cells by transfection with FUGENE 6 (Promega E2692) of pLPC-TRF2 or pLPC-Empty. Lentivirus was produced in HEK293T cells by transfection with FUGENE 6

(16) Several cell-intrinsic effectors drive type I interferon-mediated restriction of HIV-1 in primary CD4 (+) T cellsbioRxiv : the preprint server for biologyFebruary 7, 2023Itell HL, Humes D, Overbaugh J.proviral DNA and 200 μL serum-free DMEM were combined, prior to the addition of 18 μL of FuGENE (Promega #E2692). For each lentiviral transfection well, 667 ng of transfer plasmid, 500 ng of psPAX2 packing vector

(17) Myristoylated Neuronal Calcium Sensor-1 captures the ciliary vesicle at distal appendagesbioRxiv : the preprint server for biologyJanuary 10, 2023Kanie T, Ng R, Abbott KL, Pongs O, Jackson PK.dvpr, and 500 ng of lenti-viral transfer plasmids previously described along with 3 μl of Fugene 6 (E2692, Promega) transfection reagent. Media was replaced 24 hr after transfection to omit transfection reagent,

(18) A hierarchical pathway for assembly of the distal appendages that organize primary ciliabioRxiv : the preprint server for biologyJanuary 10, 2023Kanie T, Love JF, Fisher SD, Gustavsson AK, Jackson PK.ng of pCMV-dR8.2 dvpr, and 500 ng of pMCB306 plasmids described above along with 3 µl of Fugene 6 (E2692, Promega) transfection reagent. Media was replaced 24 hr after transfection to omit transfection reagent,

(19) Cholesterol transfer via endoplasmic reticulum contacts mediates lysosome damage repairThe EMBO JournalDecember 15, 2022Maja Radulovic, Eva Maria Wenzel, Sania Gilani, Lya KK Holland, Alf Håkon Lystad, Santosh Phuyal, Vesa M Olkkonen, Andreas Brech, Marja Jäättelä, Kenji Maeda, et al.5′‐TTAATCCTAAGTGGACCAAG‐3′. pX459‐derived plasmids encoding both Cas9 and the gRNA were transfected using Fugene 6 (cat. no. E2692 from Promega). Twenty‐four‐hour post‐transfection, puromycin was used to select transfected cells, these

(20) Ribosome stalling is a signal for metabolic regulation by the ribotoxic stress responseCell metabolismDecember 6, 2022Snieckute G, Genzor AV, Vind AC, Ryder L, Stoneley M, Chamois S, Dreos R, Nordgaard C, Sass F, Blasius M, et al.inhibitor: JNK-IN-8,Sigma-Aldrich,Cat#SML1246 PERKi: GSK2606414,SelleckChem,Cat#S7307 FUGENE6,Promega,Cat#E2692 RiboLock RNase Inhibitor,Thermo Fisher Scientific,Cat#EO0381 TRIzol Reagent,Thermo Fisher Scientific,Cat#15596026 NxGen RNase inhibitor

Be the First to Write a Review!